The template topicsearch could not be loaded. HTTP Status code: 0

Reading Genes

Read Complete Research Material

READING GENES

Reading Genes

Reading Genes

Refer to the following nucleic acid:

5' - ATGCTATCATTGACCTTGAGTTATTAA - 3'

1. Is this a strand of DNA or RNA? How do you know?

DNA comprises A-T and G-C pairs. RNA comprises A,U,G,C - NO T! As a result, the demonstration is DNA. The majority cellular RNA is lone strand, whereas some viruses have double strand RNA. The lone RNA strand is bent upon itself, either solely or in certain regions. In the bent district a most of the bases are complementary and are connected by hydrogen bonds (Roberts, Raff, Alberts, 2002). This assists in the steadiness of the molecule. In the unfolded district the bases have no complements. Because of this RNA does not have the purine pyrimidine equality that is discovered in DNA.

RNA furthermore disagrees from DNA in having ribose as the sugar rather than of deoxyribose. The widespread nitrogenous bases of RNA are adenine, guanine, cytosine and uracil. Thus the pyrimidine uracil alternates thymine of DNA. In districts where purine pyrimidine pairing takes location, adenine in twos with uracil and guanine with cytosine (Saenger, 2004). In supplement to the four bases cited overhead, RNA furthermore has some odd bases.

2.       If DNA, what is the complementary strand?

Complementary deoxyribonucleic unpleasant (DNA) is DNA in which the sequence of the constituent substances on one strand of the double strand structure chemically agrees the sequence on the other strand. Complementary DNA (cDNA) is a exact replicate of a district of a strand of DNA (Synder, and Champness, 2002). For demonstration, if the initial DNA stand had a sequence of ATT, the complementary sequence will be TAA. The cDNA will join to the complementary location on the DNA strand. To conceive the complementary strand immediately two A with T and G with C. Complementary DNA is significant routinely, in the construct of ...
The template citationGeneratorTemplate could not be loaded. HTTP Status code: 0
Related Ads
  • Genetic Diversity
    www.researchomatic.com...

    The genetic human has made ??tremendous progr ...

  • The Genes Behind Asthma
    www.researchomatic.com...

    It is certain about the genes and asthma that there ...

  • Tap1 And Tap2 Genes
    www.researchomatic.com...

    Explain why the mutation in the TAP2 genes leads to ...

  • Genetic Testing
    www.researchomatic.com...

    Reading DNA would be very useful, as it will ...

  • Organism’s Gnome
    www.researchomatic.com...

    The genome of a complete set of DNA of an organism, ...

The template BecomeFreememberTemplate could not be loaded. HTTP Status code: 0
The template reportTopicTemplate could not be loaded. HTTP Status code: 0
The template buyTopicStepTemplate could not be loaded. HTTP Status code: 0
The template footersearch could not be loaded. HTTP Status code: 0