HUMAN ALU

Detection of Human Alu by Polymerase Chain Reaction



Detection of Human Alu by Polymerase Chain Reaction

The Quantiblot system is based on the hybridization of a biotinylated oligonucleotide probe to extracted DNA, followed by visual comparison of the colorimetric or chemiluminescent sample results to the DNA standards. The AluQuant system utilizes a luciferase reaction that results in light output suitable for interpretation with a luminometer. These systems can become quite costly, particularly if a luminometer needs to be purchased. The Quantiblot and AluQuant systems also detect both nonhuman and human primate DNA, and the detection limit for each of these systems is approximately 0.1 ng.

The use of Alu PCR amplification has been reported to be a more sensitive method for the quantitation of genomic DNA compared to typical blot-based procedures currently used in most forensic laboratories . Note that the term “AluQuant” is a trademark of Promega Corp. and the AluQuant system may not necessarily be based on Alu mobile elements, per se. Alu elements are transposable elements which have been amplified to a copy number of over 1 million elements throughout primate evolution, producing a series of subfamilies of Alu elements that appear to be of different genetic ages. The expansion of these elements throughout primate evolution has created several recently integrated “young” Alu subfamilies that are present in the human genome but are largely absent from nonhuman primates (Deininger & Batzer, 2001).

Materials and methods

Primer Design and PCR Amplification

Oligonucleotide primers for inter-Alu PCR were Alu 3- 5'GATCGCGCCACTGCACTCC 3' and Alu 5- 5' GGATTACAGGCGTGAGCCAC 3. The intra-Yb8 primers 5' CGAGGCGGGTGGACAGAGGT 3' (positions 48-69) and 5' TCTGTCGCCCA GGC 3' (positions 273-254) have the diagnostic bases shown here in italics and underlined. The forward intra-Yd6 primer 5' GAGATCGAGACCA/GGTGAAA 3' crosses the characteristic Yd subfamily deletion, marked by the slash, whereas the reverse primer 5' TTTGAGACGGAGTCTCGT 3' contains a Yd6 subfamily-specific diagnostic mutation at the penultimate base.

Intra-Alu oligonucleotide primers were designed using either Primer3 software (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) or Primer Express software (Applied Biosystems). The need to incorporate subfamily-specific diagnostic mutations into the primer design and the high intrinsic GC content of Alu repeats made it challenging to identify oligonucleotide primers acceptable to the design software packages. Oligonucleotides were purchased from Sigma-Genosys, Inc. The SYBR green PCR core reagent kit was purchased from Applied Biosystems, Inc (Tereba & Westphal, 2001).

PCR conditions were optimized for each assay with regard to annealing temperature and concentrations of MgCl2 and oligonucleotide primers. PCRs were carried out in 50 µl using 1X SYBR green buffer, 1 mM dNTPs, and 1.25 units AmpliTaq Gold DNA polymerase as recommended by the supplier. Inter-Alu PCR used 2 µM each oligonucleotide primer and 3 mM MgCl2. Each sample was subjected to an initial denaturation of 12 min at 95 °C to activate the AmpliTaq Gold, followed by 40 amplification cycles of denaturation at 95 °C for 20 s, 56 °C to anneal for 1 min, and 1 min of extension at 72 °C. Intra-Yb8 PCR used 1 µM each oligonuclotide primer, 3 mM MgCl2, an initial denaturation of 12 min at 95 °C, ...